Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7516959
End position: 7517012
Length: 54

DNA sequence
>NC_022785, from 7516959 to 7517012 (54 bp); Streptomyces rapamycinicus NRRL 5491 GCCCGGGGGCGCGCCGGGGCCCGGGGGCGTGCCCAGGGCCGACGGCGCGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7515166-7517064	Sequence	M271_30800 - histidine kinase (Protein is coded in complementary strand; from 7517064 to 7515166)