Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7444517
End position: 7444540
Length: 24

DNA sequence
>NC_022785, from 7444517 to 7444540 (24 bp); Streptomyces rapamycinicus NRRL 5491 TCGGCCTCGGCGGCGGCCGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7443758-7444867	Sequence	M271_30420 - oxidoreductase (Protein is coded in complementary strand; from 7444867 to 7443758)