Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7401048
End position: 7401074
Length: 27

DNA sequence
>NC_022785, from 7401048 to 7401074 (27 bp); Streptomyces rapamycinicus NRRL 5491 GCCTCGCGGGCCTCGCGGGCCTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7400907-7401131	Sequence	M271_30195 - hypothetical protein (Protein is coded in complementary strand; from 7401131 to 7400907)