Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7301822
End position: 7301866
Length: 45

DNA sequence
>NC_022785, from 7301822 to 7301866 (45 bp); Streptomyces rapamycinicus NRRL 5491 CGCCGAGGGCTTCGGCGGCGAGGGCGTCCGCGCTGAGGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7301086-7303281	Sequence	M271_29760 - aromatic ring-opening dioxygenase LigA (Protein is coded in complementary strand; from 7303281 to 7301086)