Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7221318
End position: 7221344
Length: 27

DNA sequence
>NC_022785, from 7221318 to 7221344 (27 bp); Streptomyces rapamycinicus NRRL 5491 GACGCATGTGACGCATGTGACGCATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7219902-7221353	Sequence	M271_29475 - F420-0--gamma-glutamyl ligase (Protein is coded in complementary strand; from 7221353 to 7219902)