Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 721468
End position: 721503
Length: 36

DNA sequence
>NC_022785, from 721468 to 721503 (36 bp); Streptomyces rapamycinicus NRRL 5491 GCCGGGAGAGCCGGAAGACCCGGGAGAGCCGGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 720638-721849	Sequence	M271_02945 - hypothetical protein (Protein is coded in complementary strand; from 721849 to 720638)