Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7095492
End position: 7095515
Length: 24

DNA sequence
>NC_022785, from 7095492 to 7095515 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGCGGGGGAGGGGGCGCGGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7094578-7095603	Sequence	M271_28950 - 4-oxalomesaconate hydratase (Protein is coded in complementary strand; from 7095603 to 7094578)