Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7091374
End position: 7091424
Length: 51

DNA sequence
>NC_022785, from 7091374 to 7091424 (51 bp); Streptomyces rapamycinicus NRRL 5491 CGGCCGCGTGGCTACGTCGGCTACGTGGCTACCTCGGCCGCGTGGCTATAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 7091420-7092055	Sequence	M271_28935 - ATP-binding protein (Protein is coded in complementary strand; from 7092055 to 7091420)