Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7081910
End position: 7081945
Length: 36

DNA sequence
>NC_022785, from 7081910 to 7081945 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGAACCAGAACCAGAACCCGAACCCGAACCCGAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7081886-7083193	Sequence	M271_28885 - transport integral membrane protein