Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7033122
End position: 7033146
Length: 25

DNA sequence
>NC_022785, from 7033122 to 7033146 (25 bp); Streptomyces rapamycinicus NRRL 5491 CGGCGCGGTGCGCCGCGGCGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7032484-7033380	Sequence	M271_28655 - peptidoglycan-binding protein (Protein is coded in complementary strand; from 7033380 to 7032484)