Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7026934
End position: 7026957
Length: 24

DNA sequence
>NC_022785, from 7026934 to 7026957 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGCGGCCTCGGCCGCGTCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7026476-7027033	Sequence	M271_28630 - OHCU decarboxylase (Protein is coded in complementary strand; from 7027033 to 7026476)