Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 7019079
End position: 7019126
Length: 48

DNA sequence
>NC_022785, from 7019079 to 7019126 (48 bp); Streptomyces rapamycinicus NRRL 5491 CTTGCCGGAGATCTTGCCGGTGCTCTCGCCGGAGATCTTGCCGGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7017826-7019202	Sequence	M271_28590 - hypothetical protein (Protein is coded in complementary strand; from 7019202 to 7017826)