Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6996140
End position: 6996175
Length: 36

DNA sequence
>NC_022785, from 6996140 to 6996175 (36 bp); Streptomyces rapamycinicus NRRL 5491 GATCTCCCGACCGATCTCCCCACGGACCTTCCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6995895-6996707	Sequence	M271_28490 - serine/arginine repetitive matrix protein 2