Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6941209
End position: 6941232
Length: 24

DNA sequence
>NC_022785, from 6941209 to 6941232 (24 bp); Streptomyces rapamycinicus NRRL 5491 GTCGGGGTCGGGGTCGGGGTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6940489-6941514	Sequence	M271_28275 - peptidase (Protein is coded in complementary strand; from 6941514 to 6940489)