Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6928408
End position: 6928452
Length: 45

DNA sequence
>NC_022785, from 6928408 to 6928452 (45 bp); Streptomyces rapamycinicus NRRL 5491 CCCGGCCTCGCCCGTCCCGGCCATCCCCGTCCCGGCCCCGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6928097-6929599	Sequence	M271_28240 - regulatory protein (Protein is coded in complementary strand; from 6929599 to 6928097)