Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6923535
End position: 6923588
Length: 54

DNA sequence
>NC_022785, from 6923535 to 6923588 (54 bp); Streptomyces rapamycinicus NRRL 5491 CAGGGGCGGGGCCGGTGGCACGGGGGCGGCCGGTGGCACGGGGGCGGCCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6922384-6923616	Sequence	M271_28210 - hypothetical protein (Protein is coded in complementary strand; from 6923616 to 6922384)