Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6918311
End position: 6918337
Length: 27

DNA sequence
>NC_022785, from 6918311 to 6918337 (27 bp); Streptomyces rapamycinicus NRRL 5491 CCACGCCCGCCGCGCCCGCCCCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6918200-6918547	Sequence	M271_28190 - hypothetical protein (Protein is coded in complementary strand; from 6918547 to 6918200)