Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6912932
End position: 6912958
Length: 27

DNA sequence
>NC_022785, from 6912932 to 6912958 (27 bp); Streptomyces rapamycinicus NRRL 5491 GGCGTCCGGGGTGTCCGGGGTGTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6912180-6913883	Sequence	M271_28170 - transporter (Protein is coded in complementary strand; from 6913883 to 6912180)