Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6866132
End position: 6866167
Length: 36

DNA sequence
>NC_022785, from 6866132 to 6866167 (36 bp); Streptomyces rapamycinicus NRRL 5491 TCCCGTCGGGAGTCCCGTCCGGAAGCCCGTCAGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 6866162-6866668	Sequence	M271_28005 - hypothetical protein (Protein is coded in complementary strand; from 6866668 to 6866162)