Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6861993
End position: 6862037
Length: 45

DNA sequence
>NC_022785, from 6861993 to 6862037 (45 bp); Streptomyces rapamycinicus NRRL 5491 GGCGGACCAGGGAGGCGCGGGCCGGGGAGGCGCGGGCCGGGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6861011-6862135	Sequence	M271_27975 - iron ABC transporter permease (Protein is coded in complementary strand; from 6862135 to 6861011)