Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6860897
End position: 6860923
Length: 27

DNA sequence
>NC_022785, from 6860897 to 6860923 (27 bp); Streptomyces rapamycinicus NRRL 5491 TCCGCCACGTCCGCCACGTCCACCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6859869-6861014	Sequence	M271_27970 - iron ABC transporter (Protein is coded in complementary strand; from 6861014 to 6859869)