Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6858425
End position: 6858448
Length: 24

DNA sequence
>NC_022785, from 6858425 to 6858448 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCGGAGGCGAAGGCGAAGGCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6857628-6858914	Sequence	M271_27960 - aromatic ring-opening dioxygenase LigA