Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6854528
End position: 6854581
Length: 54

DNA sequence
>NC_022785, from 6854528 to 6854581 (54 bp); Streptomyces rapamycinicus NRRL 5491 GGAACCGGCCCCGACCCCGGAACCGGCCCCGACCCTGGAACCGGCCCCGGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6854268-6857333	Sequence	M271_27955 - DNA-binding protein (Protein is coded in complementary strand; from 6857333 to 6854268)