Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6830141
End position: 6830167
Length: 27

DNA sequence
>NC_022785, from 6830141 to 6830167 (27 bp); Streptomyces rapamycinicus NRRL 5491 CCGGGCAGCGCGGGCAGCCGGGGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6829514-6830521	Sequence	M271_27840 - glucosyl-3-phosphoglycerate synthase (Protein is coded in complementary strand; from 6830521 to 6829514)