Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6828490
End position: 6828534
Length: 45

DNA sequence
>NC_022785, from 6828490 to 6828534 (45 bp); Streptomyces rapamycinicus NRRL 5491 CCGCCACCGTCCCCGTCGCCACCGTCCCCGCCGCCACTGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6827749-6829257	Sequence	M271_27835 - alpha,alpha-trehalose-phosphate synthase (Protein is coded in complementary strand; from 6829257 to 6827749)