Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6814472
End position: 6814495
Length: 24

DNA sequence
>NC_022785, from 6814472 to 6814495 (24 bp); Streptomyces rapamycinicus NRRL 5491 CTGGCCCTCGCCATGGCCCTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6814035-6814631	Sequence	M271_27770 - TetR family transcriptional regulator