Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6719066
End position: 6719116
Length: 51

DNA sequence
>NC_022785, from 6719066 to 6719116 (51 bp); Streptomyces rapamycinicus NRRL 5491 TCATGCTCACGCCCCTTTGGCGCTCACGCCCCTTTGGCGCTCACGCCCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 6719107-6719784	Sequence	M271_27505 - PhoU family transcriptional regulator (Protein is coded in complementary strand; from 6719784 to 6719107)