Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6716901
End position: 6716960
Length: 60

DNA sequence
>NC_022785, from 6716901 to 6716960 (60 bp); Streptomyces rapamycinicus NRRL 5491 GCTGTTGGCGCGTCTGCTGTCGGTGTGTCTGTTGTTGGCGCGTCCGCTGTCGGCGCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6713547-6717791	Sequence	M271_27490 - hypothetical protein (Protein is coded in complementary strand; from 6717791 to 6713547)