Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6705555
End position: 6705578
Length: 24

DNA sequence
>NC_022785, from 6705555 to 6705578 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGCGGTGACGGTGGCGGTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6705535-6706329	Sequence	M271_27450 - hypothetical protein (Protein is coded in complementary strand; from 6706329 to 6705535)