Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6696006
End position: 6696053
Length: 48

DNA sequence
>NC_022785, from 6696006 to 6696053 (48 bp); Streptomyces rapamycinicus NRRL 5491 GACCCCAAGGCTGACCCCAAGGCCGAGCCCACGGCTGACCCCACGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 6694647-6696008	Sequence	M271_27400 - D-inositol 3-phosphate glycosyltransferase
ORF. 6696001-6696630	Sequence	M271_27405 - hypothetical protein