Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6685420
End position: 6685443
Length: 24

DNA sequence
>NC_022785, from 6685420 to 6685443 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCCGTTGCCCTTGCCGGTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6685244-6686191	Sequence	M271_27360 - hypothetical protein (Protein is coded in complementary strand; from 6686191 to 6685244)