Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6682810
End position: 6682845
Length: 36

DNA sequence
>NC_022785, from 6682810 to 6682845 (36 bp); Streptomyces rapamycinicus NRRL 5491 ACCGGAACTGACACCGGAACTGACACCGGAACTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6682754-6683260	Sequence	M271_27345 - DNA mismatch repair protein MutT