Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6668180
End position: 6668203
Length: 24

DNA sequence
>NC_022785, from 6668180 to 6668203 (24 bp); Streptomyces rapamycinicus NRRL 5491 GTCGGCGTCGGGGGCGGCGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6666060-6668516	Sequence	M271_27285 - signal transduction protein (Protein is coded in complementary strand; from 6668516 to 6666060)