Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6653259
End position: 6653285
Length: 27

DNA sequence
>NC_022785, from 6653259 to 6653285 (27 bp); Streptomyces rapamycinicus NRRL 5491 CTCGTCTGCCTGGTCTGCCTGGTCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6652063-6653307	Sequence	M271_27220 - threonine aldolase (Protein is coded in complementary strand; from 6653307 to 6652063)