Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6625588
End position: 6625611
Length: 24

DNA sequence
>NC_022785, from 6625588 to 6625611 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGCCTCCACCTCGGCCTCGGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6625553-6626044	Sequence	M271_27085 - inorganic pyrophosphatase (Protein is coded in complementary strand; from 6626044 to 6625553)