Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 661470
End position: 661505
Length: 36

DNA sequence
>NC_022785, from 661470 to 661505 (36 bp); Streptomyces rapamycinicus NRRL 5491 GCGAGCGCGTCGGCGACCGCGTTGGCGATCGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 661380-663812	Sequence	M271_02670 - molybdopterin-binding protein (Protein is coded in complementary strand; from 663812 to 661380)