Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6585366
End position: 6585392
Length: 27

DNA sequence
>NC_022785, from 6585366 to 6585392 (27 bp); Streptomyces rapamycinicus NRRL 5491 CCGTGGGGCCCGTGGGGCCCGTGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6585134-6586108	Sequence	M271_26900 - geranylgeranyl pyrophosphate synthase (Protein is coded in complementary strand; from 6586108 to 6585134)