Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6507152
End position: 6507205
Length: 54

DNA sequence
>NC_022785, from 6507152 to 6507205 (54 bp); Streptomyces rapamycinicus NRRL 5491 GCCCGGAGTCCGAAGGCCGCCCGGAGCCCGAGGGCGGCCGGGAGCCCGAGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6506089-6507420	Sequence	M271_26490 - hypothetical protein (Protein is coded in complementary strand; from 6507420 to 6506089)