Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6494538
End position: 6494567
Length: 30

DNA sequence
>NC_022785, from 6494538 to 6494567 (30 bp); Streptomyces rapamycinicus NRRL 5491 TCGAGGTCGAGATCCAGGTCGAGGTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6494103-6494573	Sequence	M271_26435 - LysR family transcriptional regulator