Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6411858
End position: 6411905
Length: 48

DNA sequence
>NC_022785, from 6411858 to 6411905 (48 bp); Streptomyces rapamycinicus NRRL 5491 GTTCGCGGATCGTTTCGCGGATCGGTTCGCAGACCGGTCCGCGGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6411835-6413148	Sequence	M271_26055 - cytochrome P450 (Protein is coded in complementary strand; from 6413148 to 6411835)