Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6385879
End position: 6385905
Length: 27

DNA sequence
>NC_022785, from 6385879 to 6385905 (27 bp); Streptomyces rapamycinicus NRRL 5491 GTCGTACTCGTCGTACTCGTCGTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6384947-6385921	Sequence	M271_25915 - hypothetical protein (Protein is coded in complementary strand; from 6385921 to 6384947)