Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6375257
End position: 6375280
Length: 24

DNA sequence
>NC_022785, from 6375257 to 6375280 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGCGGGGACGGGGGCCGGGGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6374787-6375659	Sequence	M271_25885 - F420-dependent oxidoreductase (Protein is coded in complementary strand; from 6375659 to 6374787)