Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6365489
End position: 6365524
Length: 36

DNA sequence
>NC_022785, from 6365489 to 6365524 (36 bp); Streptomyces rapamycinicus NRRL 5491 CTGCTCGACCGGCTGCCCGACCGGCTGCTCGACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6365280-6365552	Sequence	M271_25830 - hypothetical protein (Protein is coded in complementary strand; from 6365552 to 6365280)