Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6347203
End position: 6347256
Length: 54

DNA sequence
>NC_022785, from 6347203 to 6347256 (54 bp); Streptomyces rapamycinicus NRRL 5491 TACCGGCACCCGTACCCGTACCGGCACCCGTGCCCGTACCGGCACCCGTGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6346557-6348902	Sequence	M271_25735 - hypothetical protein (Protein is coded in complementary strand; from 6348902 to 6346557)