Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6336124
End position: 6336159
Length: 36

DNA sequence
>NC_022785, from 6336124 to 6336159 (36 bp); Streptomyces rapamycinicus NRRL 5491 CCGGGCATCAGGCCGGGCATCAGGCAGGGCGTCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 6336156-6337178	Sequence	M271_25695 - DNA primase (Protein is coded in complementary strand; from 6337178 to 6336156)