Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6334874
End position: 6334927
Length: 54

DNA sequence
>NC_022785, from 6334874 to 6334927 (54 bp); Streptomyces rapamycinicus NRRL 5491 CACGTCAGCGGTGCGAGTCATGTCAGGGGTCCGAGTCACATCAGGGGTGCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 6334915-6335712	Sequence	M271_25690 - hypothetical protein (Protein is coded in complementary strand; from 6335712 to 6334915)