Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6323795
End position: 6323830
Length: 36

DNA sequence
>NC_022785, from 6323795 to 6323830 (36 bp); Streptomyces rapamycinicus NRRL 5491 GTTTGAGCCGAGGTCCGAGCCGAGGTCCGAGCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6323679-6324074	Sequence	M271_25625 - hypothetical protein (Protein is coded in complementary strand; from 6324074 to 6323679)