Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6265582
End position: 6265617
Length: 36

DNA sequence
>NC_022785, from 6265582 to 6265617 (36 bp); Streptomyces rapamycinicus NRRL 5491 TCTCCGCGCCCTTCTCCGCGCCGTTCTCCGCGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6265521-6266141	Sequence	M271_25380 - protein-tyrosine-phosphatase (Protein is coded in complementary strand; from 6266141 to 6265521)