Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6264329
End position: 6264382
Length: 54

DNA sequence
>NC_022785, from 6264329 to 6264382 (54 bp); Streptomyces rapamycinicus NRRL 5491 TCGCCGTGCCCGATGCCGGGGCCGTGCCCGATGCCGGGGCCGTGCCCGATACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6264310-6265524	Sequence	M271_25375 - cystathionine gamma-lyase (Protein is coded in complementary strand; from 6265524 to 6264310)