Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 6229387
End position: 6229416
Length: 30

DNA sequence
>NC_022785, from 6229387 to 6229416 (30 bp); Streptomyces rapamycinicus NRRL 5491 GGTGACGGTGCCGCTGACGGTGAGGGTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6227273-6229576	Sequence	M271_25215 - membrane protein (Protein is coded in complementary strand; from 6229576 to 6227273)